glnT [2020-09-16 10:20:05]

glutamine transporter (proton symport)

Locus: BSU_02420

Isoelectric point: 10.13

Molecular weight: 49.83 kDa

Protein length: 478 aa

Gene length: 1437 bp

Function: glutamine uptake

Product: glutamine transporter (proton symport)

Essential: no

Synonyms: ybgH

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → Transporters/ other → Amino acid transporters → Solute:sodium symporter family
• Cellular processes → Transporters → Transporters/ other → Amino acid transporters → Alanine or glycine cation symporter family
• Metabolism → Amino acid/ nitrogen metabolism → Biosynthesis/ acquisition of amino acids → Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation
• Metabolism → Amino acid/ nitrogen metabolism → Utilization of amino acids → Utilization of glutamine/ glutamate
• Groups of genes → Membrane proteins

Gene

Coordinates: 262,732 → 264,168

The protein

Protein family

• Alanine or glycine:cation symporter (AGCS) (TC 2.A.25) family (according to UniProt)

Paralogous protein(s)

• AlsT, YflA, YrbD

Structure

• 6CSE (from Methanococcus maripaludis), 37.4% identity PubMed

Localization

• cell membrane (according to UniProt)

Expression and Regulation

Operons

• Genes: glsA-glnT
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • GlnL: activation, PubMed, in GlnL regulon

  Regulation

  • induced in the presence of glutamine (GlnL) PubMed

Biological materials

Mutant

• GP3503 (ΔglnT::kan), available in Jörg Stülke's lab
• MGNA-B942 (glnT::erm), available at the NBRP B. subtilis, Japan
• BKE02420 (ΔglnT::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAGAATCACCTCTTTTTT, downstream forward: _UP4_TAAGAAAAGGGTGTTCAGAC
• BKK02420 (ΔglnT::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAGAATCACCTCTTTTTT, downstream forward: _UP4_TAAGAAAAGGGTGTTCAGAC

References

Loading